pAWPSG-Ptet-nCas9-BE
(Plasmid
#195739)
-
PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195739 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAWP89
-
Backbone manufacturerMary Lidstrom
- Backbone size w/o insert (bp) 3837
- Total vector size (bp) 10918
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTet repressor protein / APOBEC1-nCas9(D10A)-UGI
-
Alt nameTetR / CBE
-
SpeciesMethylococcus capsulatus Bath, Escherichia coli
-
Insert Size (bp)7081
- Promoter Ptet(Tetracycline inducible protein)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgaaccctcccggcccgct
- 3′ sequencing primer tgctcgatgagtttttctaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWPSG-Ptet-nCas9-BE was a gift from Seung-Goo Lee (Addgene plasmid # 195739 ; http://n2t.net/addgene:195739 ; RRID:Addgene_195739) -
For your References section:
A highly efficient and versatile genetic engineering toolkit for a methanotroph-based biorefinery. Jeong J, Kim TH, Jang N, Ko M, Kim SK, Baek JI, Emelianov G, Rha E, Kwon KK, Kim H, Lee EY, Lee DH, Lee H, Lee SG. Chem Eng J, 2023 10.1016/j.cej.2022.139911
Map uploaded by the depositor.
