Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAWPSG-Ptet-nCas9-BE
(Plasmid #195739)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195739 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAWP89
  • Backbone manufacturer
    Mary Lidstrom
  • Backbone size w/o insert (bp) 3837
  • Total vector size (bp) 10918
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Tet repressor protein / APOBEC1-nCas9(D10A)-UGI
  • Alt name
    TetR / CBE
  • Species
    Methylococcus capsulatus Bath, Escherichia coli
  • Insert Size (bp)
    7081
  • Promoter Ptet(Tetracycline inducible protein)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcgaaccctcccggcccgct
  • 3′ sequencing primer tgctcgatgagtttttctaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAWPSG-Ptet-nCas9-BE was a gift from Seung-Goo Lee (Addgene plasmid # 195739 ; http://n2t.net/addgene:195739 ; RRID:Addgene_195739)
  • For your References section:

    A highly efficient and versatile genetic engineering toolkit for a methanotroph-based biorefinery. Jeong J, Kim TH, Jang N, Ko M, Kim SK, Baek JI, Emelianov G, Rha E, Kwon KK, Kim H, Lee EY, Lee DH, Lee H, Lee SG. Chem Eng J, 2023 10.1016/j.cej.2022.139911