Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_hSynapsin1_NOPLight1
(Plasmid #195580)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195580 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hSynapsin1
  • Backbone manufacturer
    UZH Viral Vector Facility
  • Backbone size w/o insert (bp) 4464
  • Total vector size (bp) 6387
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NOPLight1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1923
  • Promoter human Synapsin-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gtcgagattaattaactcgagcaggtaag
  • 3′ sequencing primer cgccacgttgcctgacaacgggccacaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSynapsin1_NOPLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 195580 ; http://n2t.net/addgene:195580 ; RRID:Addgene_195580)
  • For your References section:

    Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide release. Zhou X, Stine C, Prada PO, Fusca D, Assoumou K, Dernic J, Bhat MA, Achanta AS, Johnson JC, Jadhav S, Bauder CA, Steuernagel L, Ravotto L, Benke D, Weber B, Stoeber M, Kloppenburg P, Bruning JC, Bruchas MR, Patriarchi T. bioRxiv. 2023 Jun 1:2023.05.26.542102. doi: 10.1101/2023.05.26.542102. Preprint. 10.1101/2023.05.26.542102 PubMed 37292957