Skip to main content
Addgene

pAAV_hSynapsin1_NOPLight1
(Plasmid #195580)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195580 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-hSynapsin1
  • Backbone manufacturer
    UZH Viral Vector Facility
  • Backbone size w/o insert (bp) 4464
  • Total vector size (bp) 6387
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NOPLight1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1923
  • Promoter human Synapsin-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gtcgagattaattaactcgagcaggtaag
  • 3′ sequencing primer cgccacgttgcctgacaacgggccacaac
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSynapsin1_NOPLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 195580 ; http://n2t.net/addgene:195580 ; RRID:Addgene_195580)

  • For your References section:

    Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide release. Zhou X, Stine C, Prada PO, Fusca D, Assoumou K, Dernic J, Bhat MA, Achanta AS, Johnson JC, Pasqualini AL, Jadhav S, Bauder CA, Steuernagel L, Ravotto L, Benke D, Weber B, Suko A, Palmiter RD, Stoeber M, Kloppenburg P, Bruning JC, Bruchas MR, Patriarchi T. Nat Commun. 2024 Jun 25;15(1):5353. doi: 10.1038/s41467-024-49712-0. 10.1038/s41467-024-49712-0 PubMed 38918403
Related items:
Commonly requested with: