pCMV_NOPLight-ctr
(Plasmid
#195579)
-
PurposeExpresses the control sensor NOPLight-ctr in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 5909
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNOPLight-ctr
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1923
-
MutationD110A, D130A
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ttccaaaatgtcgtaacaactccgcc
- 3′ sequencing primer ttgctttatttgtaaccattataagctgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See https://www.biorxiv.org/content/10.1101/2023.05.26.542102v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_NOPLight-ctr was a gift from Tommaso Patriarchi (Addgene plasmid # 195579 ; http://n2t.net/addgene:195579 ; RRID:Addgene_195579) -
For your References section:
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide release. Zhou X, Stine C, Prada PO, Fusca D, Assoumou K, Dernic J, Bhat MA, Achanta AS, Johnson JC, Pasqualini AL, Jadhav S, Bauder CA, Steuernagel L, Ravotto L, Benke D, Weber B, Suko A, Palmiter RD, Stoeber M, Kloppenburg P, Bruning JC, Bruchas MR, Patriarchi T. Nat Commun. 2024 Jun 25;15(1):5353. doi: 10.1038/s41467-024-49712-0. 10.1038/s41467-024-49712-0 PubMed 38918403