Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-STAT3
(Plasmid #195575)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195575 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 6903
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Signal transducer and activator of transcription 3
  • Alt name
    STAT3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2310
  • GenBank ID
    NM_213659.3
  • Entrez Gene
    Stat3 (a.k.a. 1110034C02Rik, Aprf)
  • Promoter CMV enhancer and promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-STAT3 was a gift from Kevin Park (Addgene plasmid # 195575 ; http://n2t.net/addgene:195575 ; RRID:Addgene_195575)
  • For your References section:

    Enhanced Transcriptional Activity and Mitochondrial Localization of STAT3 Co-induce Axon Regrowth in the Adult Central Nervous System. Luo X, Ribeiro M, Bray ER, Lee DH, Yungher BJ, Mehta ST, Thakor KA, Diaz F, Lee JK, Moraes CT, Bixby JL, Lemmon VP, Park KK. Cell Rep. 2016 Apr 12;15(2):398-410. doi: 10.1016/j.celrep.2016.03.029. Epub 2016 Mar 31. 10.1016/j.celrep.2016.03.029 PubMed 27050520