pAAV-STAT3
(Plasmid
#195575)
-
PurposeExpresses STAT3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195575 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 6903
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSignal transducer and activator of transcription 3
-
Alt nameSTAT3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2310
-
GenBank IDNM_213659.3
-
Entrez GeneStat3 (a.k.a. 1110034C02Rik, Aprf)
- Promoter CMV enhancer and promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-STAT3 was a gift from Kevin Park (Addgene plasmid # 195575 ; http://n2t.net/addgene:195575 ; RRID:Addgene_195575) -
For your References section:
Enhanced Transcriptional Activity and Mitochondrial Localization of STAT3 Co-induce Axon Regrowth in the Adult Central Nervous System. Luo X, Ribeiro M, Bray ER, Lee DH, Yungher BJ, Mehta ST, Thakor KA, Diaz F, Lee JK, Moraes CT, Bixby JL, Lemmon VP, Park KK. Cell Rep. 2016 Apr 12;15(2):398-410. doi: 10.1016/j.celrep.2016.03.029. Epub 2016 Mar 31. 10.1016/j.celrep.2016.03.029 PubMed 27050520