Skip to main content
Addgene

pAAV.U6.shRNA-Sdc1-1376
(Plasmid #195574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195574 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV.U6.shRNA.CMV.eGFP.WPRE
  • Backbone size w/o insert (bp) 6201
  • Total vector size (bp) 6257
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA, eGFP
  • gRNA/shRNA sequence
    GCTTGGGTGCAAAGGGTTTCT
  • Species
    Synthetic
  • Entrez Gene
    Sdc1 (a.k.a. CD138, Sstn, Synd, Synd1, syn-1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRi (not destroyed)
  • 5′ sequencing primer GATACAAGGCTGTTAGAGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.U6.shRNA-Sdc1-1376 was a gift from Kevin Park (Addgene plasmid # 195574 ; http://n2t.net/addgene:195574 ; RRID:Addgene_195574)
  • For your References section:

    Thrombospondin-1 Mediates Axon Regeneration in Retinal Ganglion Cells. Bray ER, Yungher BJ, Levay K, Ribeiro M, Dvoryanchikov G, Ayupe AC, Thakor K, Marks V, Randolph M, Danzi MC, Schmidt TM, Chaudhari N, Lemmon VP, Hattar S, Park KK. Neuron. 2019 Aug 21;103(4):642-657.e7. doi: 10.1016/j.neuron.2019.05.044. Epub 2019 Jun 26. 10.1016/j.neuron.2019.05.044 PubMed 31255486