pTet-Bxb1-Xis-mScarlet
(Plasmid
#195570)
-
PurposeExpresses Bxb1 excisionase fused with mScarlet for fluorescence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneColE1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 12.5 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBxb1 Excisionase Fused With mScarlet
-
SpeciesSynthetic
-
Insert Size (bp)3577
- Promoter P7
-
Tag
/ Fusion Protein
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAAAACGCCAGCAACGCGGCC
- 3′ sequencing primer CATTTTCGCCAAAAGTTGGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTet-Bxb1-Xis-mScarlet was a gift from Richard Murray (Addgene plasmid # 195570 ; http://n2t.net/addgene:195570 ; RRID:Addgene_195570) -
For your References section:
Characterization of Integrase and Excisionase Activity in a Cell-Free Protein Expression System Using a Modeling and Analysis Pipeline. Pandey A, Rodriguez ML, Poole W, Murray RM. ACS Synth Biol. 2023 Feb 17;12(2):511-523. doi: 10.1021/acssynbio.2c00534. Epub 2023 Jan 30. 10.1021/acssynbio.2c00534 PubMed 36715625