Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CaMKII-pAceR-Kv2.1PR
(Plasmid #195531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195531 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CaMKII
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pAceR-Kv2.1 proximal restriction sequence
  • Species
    Synthetic
  • Mutation
    VARNAM 78E, 81D, 92N; SI linker
  • GenBank ID
    OM687166
  • Promoter CaMKII

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
  • 3′ sequencing primer GGCCACAACTCCTCATAAAGAGACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKII-pAceR-Kv2.1PR was a gift from Vincent Pieribone (Addgene plasmid # 195531 ; http://n2t.net/addgene:195531 ; RRID:Addgene_195531)
  • For your References section:

    Dual-polarity voltage imaging of the concurrent dynamics of multiple neuron types. Kannan M, Vasan G, Haziza S, Huang C, Chrapkiewicz R, Luo J, Cardin JA, Schnitzer MJ, Pieribone VA. Science. 2022 Nov 4;378(6619):eabm8797. doi: 10.1126/science.abm8797. Epub 2022 Nov 4. 10.1126/science.abm8797 PubMed 36378956