pAAV-Syn-Ace-mNeon2
(Plasmid
#195518)
-
PurposeGreen fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Synapsin
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAce-mNeon2
-
SpeciesSynthetic
-
MutationAce-mNeon 81S; SY linker
- Promoter Synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
- 3′ sequencing primer GGCCACAACTCCTCATAAAGAGACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-Ace-mNeon2 was a gift from Vincent Pieribone (Addgene plasmid # 195518 ; http://n2t.net/addgene:195518 ; RRID:Addgene_195518) -
For your References section:
Dual-polarity voltage imaging of the concurrent dynamics of multiple neuron types. Kannan M, Vasan G, Haziza S, Huang C, Chrapkiewicz R, Luo J, Cardin JA, Schnitzer MJ, Pieribone VA. Science. 2022 Nov 4;378(6619):eabm8797. doi: 10.1126/science.abm8797. Epub 2022 Nov 4. 10.1126/science.abm8797 PubMed 36378956