Skip to main content
Addgene

pAAV-CNTF-HA
(Plasmid #195517)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195517 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 6052
  • Modifications to backbone
    Ribeiro M, Ayupe AC, Beckedorff FC, Levay K, Rodriguez S, Tsoulfas P, Lee JK, Nascimento-dos-Santos G, Park KK. Retinal ganglion cell expression of cytokine enhances occupancy of NG2 cell-derived astrocytes at the nerve injury site: Implication for axon regeneration
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ciliary neurotrophic factor
  • Alt name
    CNTF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    651
  • GenBank ID
    NM_000614.4
  • Entrez Gene
    CNTF (a.k.a. HCNTF)
  • Promoter UbC promoter with beta-globin intron
  • Tags / Fusion Proteins
    • NGF signal peptide (N terminal on insert)
    • HA-tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer caacctggactctgcggatg
  • 3′ sequencing primer catcccatccgcagagtcc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CNTF-HA was a gift from Kevin Park (Addgene plasmid # 195517 ; http://n2t.net/addgene:195517 ; RRID:Addgene_195517)

  • For your References section:

    Retinal ganglion cell expression of cytokine enhances occupancy of NG2 cell-derived astrocytes at the nerve injury site: Implication for axon regeneration. Ribeiro M, Ayupe AC, Beckedorff FC, Levay K, Rodriguez S, Tsoulfas P, Lee JK, Nascimento-Dos-Santos G, Park KK. Exp Neurol. 2022 Sep;355:114147. doi: 10.1016/j.expneurol.2022.114147. Epub 2022 Jun 20. 10.1016/j.expneurol.2022.114147 PubMed 35738417
Related items:
Commonly requested with: