pCMV-MMLV-gag-hMLH1dn
(Plasmid #195513)

• Purpose: MMLV-Gag fused to hMLH1dn with TSTLLMENSS cleavage site between Gag-NES and hMLH1dn. For production of virus like particles with base-editor RNP cargo.
• Depositing Lab: Hyongbum Kim
• Publication: Yu et al Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034.

Backbone

• Vector backbone: pCMV-MMLVgag-3xNES-Cas9
• Backbone manufacturer: David Liu
• Backbone size w/o insert (bp): 4021
• Total vector size (bp): 10783
• Vector type: Mammalian Expression ; Virus like particle

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hMLH1dn
• Alt name: Human MLH1 del754-756
• Species: H. sapiens (human)
• Insert Size (bp): 2256
• Mutation: Human MLH1 del754-756
• Entrez Gene: MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, LYNCH2, MLH-1, MMRCS1, hMLH1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (N terminal on backbone)
  • Protease cleavate site (N terminal on backbone)
  • NES (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctctgagtccaaaccgggcc
• 3′ sequencing primer: CCCATATGTCCTTCCGAGTG

Resource Information

• Supplemental Documents:
  • gag-MLH1dn.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry