Skip to main content
Addgene

pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
(Plasmid #195504)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195504 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 9174
  • Total vector size (bp) 9177
  • Modifications to backbone
    sgRNA targeting Exon 1 of human lncRNA T-REX17
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    GTGAGAGGAACCATCTTCAGG
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr8:55140763-55140783
  • Promoter U6
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • T2A (C terminal on insert)
    • Puro (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGATACAAGGCTGTTAGAGAG
  • 3′ sequencing primer ggaaagtccctattggcgtta
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNA was ordered from Sigma-Aldrich as synthetic ssODN oligonucleotide

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note there is a A to S mutation in Puromycin but this has no impact on the Puromycin selection cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI was a gift from Alexander Meissner (Addgene plasmid # 195504 ; http://n2t.net/addgene:195504 ; RRID:Addgene_195504)

  • For your References section:

    T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724
Related items: