Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
(Plasmid #195502)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195502 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Plasmid #42335)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8430
  • Total vector size (bp) 8432
  • Modifications to backbone
    sgRNA targeting Exon 2 of human SOX17
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    GCAGTAATATACCGCGGAGT
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr8:55372518-55372537
  • Entrez Gene
    SOX17 (a.k.a. VUR3)
  • Promoter U6
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGATACAAGGCTGTTAGAGAG
  • 3′ sequencing primer ggaaagtccctattggcgtta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNA was ordered from Sigma-Aldrich as synthetic ssODN oligonucleotide

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI was a gift from Alexander Meissner (Addgene plasmid # 195502 ; http://n2t.net/addgene:195502 ; RRID:Addgene_195502)
  • For your References section:

    T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724