Skip to main content
Addgene

pU6-sgT-REX17_EF1a-Puro-T2A-BFP
(Plasmid #195501)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-sgRNA EF1Alpha-puro-T2A-BFP (Plasmid #60955)
  • Backbone manufacturer
    Jonathan Weissman
  • Backbone size w/o insert (bp) 8877
  • Total vector size (bp) 8885
  • Modifications to backbone
    sgRNA sequence with a human unrelated target
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    AGTGGTGTGGATTTCGGCAG
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr8:55141135-55141154
  • Tags / Fusion Proteins
    • Puro (C terminal on backbone)
    • T2A (C terminal on backbone)
    • BFP (C terminal on backbone)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNA was ordered from Sigma-Aldrich as synthetic ssODN oligonucleotide

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-sgT-REX17_EF1a-Puro-T2A-BFP was a gift from Alexander Meissner (Addgene plasmid # 195501 ; http://n2t.net/addgene:195501 ; RRID:Addgene_195501)
  • For your References section:

    T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724