Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSET.HaloTag.v7.CoOp.Cys-less
(Plasmid #195487)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSET
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2863
  • Total vector size (bp) 3763
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag.v7
  • Insert Size (bp)
    900
  • Mutation
    C61T, C262V
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHIS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Made at the request of and in collaboration with Erik L. Snapp using human codon bias/preference of highly expressed genes as reported by Haas et al. (1996). For use in oxidizing environments, such as the eukaryotic secretory pathway or bacterial periplasmic space.

Haas, J., Park, E. C., & Seed, B. (1996). Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Current biology : CB, 6(3), 315–324. https://doi.org/10.1016/s0960-9822(02)00482-7

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSET.HaloTag.v7.CoOp.Cys-less was a gift from Tim Brown & HHMI-JRC Tool Translation Team (Addgene plasmid # 195487 ; http://n2t.net/addgene:195487 ; RRID:Addgene_195487)