pRSET.HaloTag.v7.CoOp.Cys-less
(Plasmid #195487)

• Purpose: Bacterial expression plasmid with HaloTag v7 insert; modified to replace cysteines C61, C262, and optimized to human codon bias/preference for use in oxidizing environments.
• Depositing Labs: Tim Brown, HHMI-JRC Tool Translation Team
• Publication: Bacterial expression plasmids of HaloTag v7 variants (unpublished)

Backbone

• Vector backbone: pRSET
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2863
• Total vector size (bp): 3763
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HaloTag.v7
• Insert Size (bp): 900
• Mutation: C61T, C262V
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHIS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pRSET.HaloTagv7.CodonOpti.Cys-less.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Made at the request of and in collaboration with Erik L. Snapp using human codon bias/preference of highly expressed genes as reported by Haas et al. (1996). For use in oxidizing environments, such as the eukaryotic secretory pathway or bacterial periplasmic space.

Haas, J., Park, E. C., & Seed, B. (1996). Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Current biology : CB, 6(3), 315–324. https://doi.org/10.1016/s0960-9822(02)00482-7