Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-ASAP3ER
(Plasmid #195356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195356 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGs
  • Backbone size w/o insert (bp) 6102
  • Total vector size (bp) 7395
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ASAP3ER
  • Insert Size (bp)
    1293
  • Promoter pCAG
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer caggtgcaggctgcctatc
  • 3′ sequencing primer gcacagtcgaggctgatcagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-ASAP3ER was a gift from Brenda Bloodgood (Addgene plasmid # 195356 ; http://n2t.net/addgene:195356 ; RRID:Addgene_195356)
  • For your References section:

    Electrical signals in the ER are cell type and stimulus specific with extreme spatial compartmentalization in neurons. Campbell EP, Abushawish AA, Valdez LA, Bell MK, Haryono M, Rangamani P, Bloodgood BL. Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5. 10.1016/j.celrep.2022.111943 PubMed 36640310