pAAV-CNTF
(Plasmid
#195338)
-
PurposeExpression of CNTF in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 6027
-
Modifications to backboneB J Yungher, X Luo, Y Salgueiro, M G Blackmore, K K Park (2015) Viral vector-based improvement of optic nerve regeneration: characterization of individual axons' growth patterns and synaptogenesis in a visual target.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCiliary neurotrophic factor
-
Alt nameCNTF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)651
-
GenBank IDNM_000614.4
-
Entrez GeneCNTF (a.k.a. HCNTF)
- Promoter UbC promoter with beta-globin intron
-
Tag
/ Fusion Protein
- NGF signal peptide (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer caacctggactctgcggatg
- 3′ sequencing primer catcccatccgcagagtcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CNTF was a gift from Kevin Park (Addgene plasmid # 195338 ; http://n2t.net/addgene:195338 ; RRID:Addgene_195338) -
For your References section:
Viral vector-based improvement of optic nerve regeneration: characterization of individual axons' growth patterns and synaptogenesis in a visual target. Yungher BJ, Luo X, Salgueiro Y, Blackmore MG, Park KK. Gene Ther. 2015 Oct;22(10):811-21. doi: 10.1038/gt.2015.51. Epub 2015 May 25. 10.1038/gt.2015.51 PubMed 26005861