pAAV-CNTF
(Plasmid #195338)

• Purpose: Expression of CNTF in mammalian cells
• Depositing Lab: Kevin Park
• Publication: Yungher et al Gene Ther. 2015 Oct;22(10):811-21. doi: 10.1038/gt.2015.51. Epub 2015 May 25.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4650
• Total vector size (bp): 6027
• Modifications to backbone: B J Yungher, X Luo, Y Salgueiro, M G Blackmore, K K Park (2015) Viral vector-based improvement of optic nerve regeneration: characterization of individual axons' growth patterns and synaptogenesis in a visual target.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ciliary neurotrophic factor
• Alt name: CNTF
• Species: H. sapiens (human)
• Insert Size (bp): 651
• GenBank ID: NM_000614.4
• Entrez Gene: CNTF (a.k.a. HCNTF)
• Promoter: UbC promoter with beta-globin intron
• Tag / Fusion Protein:
  • NGF signal peptide (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: caacctggactctgcggatg
• 3′ sequencing primer: catcccatccgcagagtcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry