SBE-NLS-mCherry PGK-rtTA3
(Plasmid #195332)

• Purpose: Lentiviral construct of TGFβ reporter (nuclear mCherry) and hPGK driven rtTA3
• Depositing Lab: Elaine Fuchs
• Publication: Yuan et al Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6.

Backbone

• Vector backbone: PLKO
• Vector type: Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NLS-mCherry
• Species: Synthetic
• Insert Size (bp): 762
• Promoter: miniCMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTCGCTCAAAAGCTGGGAGT
• 3′ sequencing primer: AGATCTTGTCTTCGTTGGGAGTGA

Gene/Insert 2

• Gene/Insert name: rtTA3
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTAGTGTGGGCCCTGTTCCTGCC
• 3′ sequencing primer: AGCACAGCGGTATGACTTGG

Resource Information

• Supplemental Documents:
  • copy-of-plko-revn-rtta3-sbe-nmche-scramble.gb
• A portion of this plasmid was derived from a plasmid made by: Naoki Oshimori

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry