Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_Flex_syn_SpikeyGi2_kv2.1
(Plasmid #195314)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195314 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV-Syn-FLEX
  • Backbone manufacturer
    original from Stratagene
  • Backbone size w/o insert (bp) 4661
  • Total vector size (bp) 6189
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpikeyGi2
  • Species
    Synthetic
  • Insert Size (bp)
    1284
  • Promoter human synapsin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site KpnI (destroyed during cloning)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer aaagcagcgtatccacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_Flex_syn_SpikeyGi2_kv2.1 was a gift from Vincent Pieribone (Addgene plasmid # 195314 ; http://n2t.net/addgene:195314 ; RRID:Addgene_195314)
  • For your References section:

    High-speed low-light in vivo two-photon voltage imaging of large neuronal populations. Platisa J, Ye X, Ahrens AM, Liu C, Chen IA, Davison IG, Tian L, Pieribone VA, Chen JL. Nat Methods. 2023 Mar 27. doi: 10.1038/s41592-023-01820-3. 10.1038/s41592-023-01820-3 PubMed 36973547