Skip to main content
Addgene

pAAV_hSyn_SpikeyGi2_kv2.1
(Plasmid #195313)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195313 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hsyn-EGFP (Addgene plasmid #50465)
  • Backbone manufacturer
    Bryan Roth
  • Backbone size w/o insert (bp) 4525
  • Total vector size (bp) 6056
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpikeyGi2
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    1284
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSyn_SpikeyGi2_kv2.1 was a gift from Vincent Pieribone (Addgene plasmid # 195313 ; http://n2t.net/addgene:195313 ; RRID:Addgene_195313)
  • For your References section:

    High-speed low-light in vivo two-photon voltage imaging of large neuronal populations. Platisa J, Ye X, Ahrens AM, Liu C, Chen IA, Davison IG, Tian L, Pieribone VA, Chen JL. Nat Methods. 2023 Mar 27. doi: 10.1038/s41592-023-01820-3. 10.1038/s41592-023-01820-3 PubMed 36973547