Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOPO794
(Plasmid #195303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195303 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD322
  • Backbone size w/o insert (bp) 4955
  • Total vector size (bp) 9874
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    McCAST Cascade Δcas6 and ribozyme flanked entry site
  • Species
    Myxacorys californica WJT36-NPBG1
  • Insert Size (bp)
    4923
  • GenBank ID
    JAHHHO010000011 DQ119282.1
  • Promoter Arabinose inducible arapBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCACATTGATTATTTGCACGGCG
  • 3′ sequencing primer CTGGCAGTTCCCTACTCTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPO794 was a gift from Joseph Peters (Addgene plasmid # 195303 ; http://n2t.net/addgene:195303 ; RRID:Addgene_195303)
  • For your References section:

    Discovery and characterization of novel type I-D CRISPR-guided transposons identified among diverse Tn7-like elements in cyanobacteria. Hsieh SC, Peters JE. Nucleic Acids Res. 2023 Jan 25;51(2):765-782. doi: 10.1093/nar/gkac1216. 10.1093/nar/gkac1216 PubMed 36537206