pOPO717
(Plasmid #195302)

• Purpose: pBAD322-MycaIDCas-lacZsp5, arapBAD promoter expressing type I-D Cascade and one spacer array of McCAST (Tn7575), the single spacer is lacZ spacer 5.
• Depositing Lab: Joseph Peters
• Publication: Hsieh et al Nucleic Acids Res. 2023 Jan 25;51(2):765-782. doi: 10.1093/nar/gkac1216.

Backbone

• Vector backbone: pBAD322
• Backbone size w/o insert (bp): 4955
• Total vector size (bp): 10880
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: McCAST Cascade and lacZ spacer 5 in native array
• Species: Myxacorys californica WJT36-NPBG1
• Insert Size (bp): 5949
• GenBank ID: JAHHHO010000011 DQ119282.1
• Promoter: Arabinose inducible arapBAD

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCACATTGATTATTTGCACGGCG
• 3′ sequencing primer: CTGGCAGTTCCCTACTCTCG

Resource Information

• Supplemental Documents:
  • pBAD322-MycaIDCas-lacZsp5.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry