pOPO640
(Plasmid
#195296)
-
PurposepTA106-Myacmini-KanR, donor plasmid with mini-transposon of McCAST (Tn7575).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTA106
- Backbone size w/o insert (bp) 4217
- Total vector size (bp) 3961
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameminiMcCAST (Tn7575) with KanR
-
SpeciesMyxacorys californica WJT36-NPBG1
-
Insert Size (bp)1859
-
GenBank IDJAHHHO010000011
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer tacatatcaaagggaaaactgtccatatg
- 3′ sequencing primer AGGCTTAAGTAGCACCCTCGCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPO640 was a gift from Joseph Peters (Addgene plasmid # 195296 ; http://n2t.net/addgene:195296 ; RRID:Addgene_195296) -
For your References section:
Discovery and characterization of novel type I-D CRISPR-guided transposons identified among diverse Tn7-like elements in cyanobacteria. Hsieh SC, Peters JE. Nucleic Acids Res. 2023 Jan 25;51(2):765-782. doi: 10.1093/nar/gkac1216. 10.1093/nar/gkac1216 PubMed 36537206