pDA313
(Plasmid
#195214)
-
PurposeExpression of superfolder GFP (sfGFP) by a hybrid T7 promoter with tetO.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 3520
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP with tetO and a hairpin
-
SpeciesSynthetic
-
Insert Size (bp)809
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGCCGATTCATTAATGCAGG
- 3′ sequencing primer GCCCCAAGGGGTTATGCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDA313 was a gift from Rahul Sarpeshkar (Addgene plasmid # 195214 ; http://n2t.net/addgene:195214 ; RRID:Addgene_195214) -
For your References section:
Rapid modeling of experimental molecular kinetics with simple electronic circuits instead of with complex differential equations. Deng Y, Beahm DR, Ran X, Riley TG, Sarpeshkar R. Front Bioeng Biotechnol. 2022 Sep 28;10:947508. doi: 10.3389/fbioe.2022.947508. eCollection 2022. 10.3389/fbioe.2022.947508 PubMed 36246369