Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CaMKIIa-DIO eHcKCR1 3.0-oScarlett-KV2.1
(Plasmid #195198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195198 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5623
  • Total vector size (bp) 7399
  • Modifications to backbone
    Lox P and Lox2722 added to make this a cre-dependant construct under the CaMKIIa promoter
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eHcKCR1 3.0-oScarlet-Kv2.1
  • Species
    Synthetic
  • Insert Size (bp)
    1776
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTGGATGCTGACGAAGGCTCG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-DIO eHcKCR1 3.0-oScarlett-KV2.1 was a gift from Karl Deisseroth (Addgene plasmid # 195198 ; http://n2t.net/addgene:195198 ; RRID:Addgene_195198)
  • For your References section:

    All-optical physiology resolves a synaptic basis for behavioral timescale plasticity. Fan LZ, Kim DK, Jennings JH, Tian H, Wang PY, Ramakrishnan C, Randles S, Sun Y, Thadhani E, Kim YS, Quirin S, Giocomo L, Cohen AE, Deisseroth K. Cell. 2023 Feb 2;186(3):543-559.e19. doi: 10.1016/j.cell.2022.12.035. Epub 2023 Jan 19. 10.1016/j.cell.2022.12.035 PubMed 36669484