Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA3.1_WiChR_TS_mScarlet_ER
(Plasmid #195190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195190 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone size w/o insert (bp) 5366
  • Total vector size (bp) 7096
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wobblia lunata inhibitory Channelrhodopsin
  • Alt name
    WiChR
  • Alt name
    WlChR1
  • Alt name
    WlKCR1
  • Species
    Synthetic; Wobblia lunata
  • Insert Size (bp)
    933
  • GenBank ID
    OP710241.1 UZU83954.1
  • Promoter CMV
  • Tags / Fusion Proteins
    • Kir2.1 trafficking motif (C terminal on insert)
    • mScarlet (C terminal on insert)
    • ER-export sequence (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AGCCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3.1_WiChR_TS_mScarlet_ER was a gift from Peter Hegemann & Johannes Vierock (Addgene plasmid # 195190 ; http://n2t.net/addgene:195190 ; RRID:Addgene_195190)
  • For your References section:

    WiChR, a highly potassium selective channelrhodopsin for low-light one- and two-photon inhibition of excitable cells. Vierock J, Peter E, Grimm C, Rozenberg A, Chen IW, Tillert L, Castro Scalise AG, Casini M, Augustin S, Tanese D, Forget BC, Peyronnet R, Schneider-Warme F, Emiliani V, Beja O, Hegemann P. Sci Adv. 2022 Nov 16:eadd7729. 10.1126/sciadv.add7729 PubMed 36383037