Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MDM4_Deletion_Upstream_gRNA_1
(Plasmid #195134)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195134 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lenti-Cas9-gRNA-GFP
  • Vector type
    Mammalian Expression
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MDM4 Deletion Upstream gRNA 1
  • gRNA/shRNA sequence
    TCAATGGTAAAATAGATCGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MDM4 (a.k.a. BMFS6, HDMX, MDMX, MRP1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.01.09.523344 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDM4_Deletion_Upstream_gRNA_1 was a gift from Jason Sheltzer (Addgene plasmid # 195134 ; http://n2t.net/addgene:195134 ; RRID:Addgene_195134)
  • For your References section:

    Oncogene-like addiction to aneuploidy in human cancers. Girish V, Lakhani AA, Thompson SL, Scaduto CM, Brown LM, Hagenson RA, Sausville EL, Mendelson BE, Kandikuppa PK, Lukow DA, Yuan ML, Stevens EC, Lee SN, Schukken KM, Akalu SM, Vasudevan A, Zou C, Salovska B, Li W, Smith JC, Taylor AM, Martienssen RA, Liu Y, Sun R, Sheltzer JM. Science. 2023 Jul 6:eadg4521. doi: 10.1126/science.adg4521. 10.1126/science.adg4521 PubMed 37410869