Chr7_Centromere-Targeting_gRNA
(Plasmid
#195129)
-
Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLenti-Cas9-gRNA-GFP
-
Vector typeMammalian Expression
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChr7 gRNA
-
gRNA/shRNA sequenceAGTAAACTCCAACAGACCTG; TGATTCAATTGGAAGCCAAT
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.09.523344 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Chr7_Centromere-Targeting_gRNA was a gift from Jason Sheltzer (Addgene plasmid # 195129 ; http://n2t.net/addgene:195129 ; RRID:Addgene_195129) -
For your References section:
Oncogene-like addiction to aneuploidy in human cancers. Girish V, Lakhani AA, Thompson SL, Scaduto CM, Brown LM, Hagenson RA, Sausville EL, Mendelson BE, Kandikuppa PK, Lukow DA, Yuan ML, Stevens EC, Lee SN, Schukken KM, Akalu SM, Vasudevan A, Zou C, Salovska B, Li W, Smith JC, Taylor AM, Martienssen RA, Liu Y, Sun R, Sheltzer JM. Science. 2023 Jul 6:eadg4521. doi: 10.1126/science.adg4521. 10.1126/science.adg4521 PubMed 37410869