221-pCAGGS-HA-AID-CTCFcDNA-AID-eGFP-2A-blasticidin
(Plasmid #195101)

• Purpose: Vector to introduce human CTCF cDNA tagged with eGFP and two AIDs in the cells. Blasticidin selection (2A-fusion). Auxin-inducible degron system.
• Depositing Lab: Job Dekker
• Publication: Valton et al Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9.

Backbone

• Vector backbone: pENTR221
• Total vector size (bp): 8087
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CTCF
• Species: H. sapiens (human)
• Entrez Gene: CTCF (a.k.a. CFAP108, FAP108, MRD21)
• Promoter: pCAGGS
• Tags / Fusion Proteins:
  • eGFP (C terminal on insert)
  • AID (C terminal on insert)
  • AID (N terminal on insert)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTAGAGCCTCTGCTAACCATGTTCATGC
• 3′ sequencing primer: GGTGGTGCAGATGAACTTCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The CTCF cDNA was amplified from a pCMV6-Entry vector containing CTCF cDNA (Origene, RC202416)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.07.29.454218v1 for bioRxiv preprint.