221-pCAGGS-HA-AID-CTCFcDNA-AID-eGFP-2A-blasticidin
(Plasmid
#195101)
-
PurposeVector to introduce human CTCF cDNA tagged with eGFP and two AIDs in the cells. Blasticidin selection (2A-fusion). Auxin-inducible degron system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR221
- Total vector size (bp) 8087
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTCF
-
SpeciesH. sapiens (human)
- Promoter pCAGGS
-
Tags
/ Fusion Proteins
- eGFP (C terminal on insert)
- AID (C terminal on insert)
- AID (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTCATGC
- 3′ sequencing primer GGTGGTGCAGATGAACTTCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe CTCF cDNA was amplified from a pCMV6-Entry vector containing CTCF cDNA (Origene, RC202416)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.29.454218v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
221-pCAGGS-HA-AID-CTCFcDNA-AID-eGFP-2A-blasticidin was a gift from Job Dekker (Addgene plasmid # 195101 ; http://n2t.net/addgene:195101 ; RRID:Addgene_195101) -
For your References section:
A cohesin traffic pattern genetically linked to gene regulation. Valton AL, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, Chan K, Pai AA, Moffat J, Dekker J. Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9. 10.1038/s41594-022-00890-9 PubMed 36482254