Hy_pAna eGFP SV40
(Plasmid
#195063)
-
PurposeExpresses eGFP mRNA from the Drosophila Ana promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMtnA eGFP
- Total vector size (bp) 9361
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
- Promoter Ana
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTACCTGCCTGGACAGCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pAna eGFP SV40 was a gift from Jeremy Wilusz (Addgene plasmid # 195063 ; http://n2t.net/addgene:195063 ; RRID:Addgene_195063) -
For your References section:
IntS6 and the Integrator phosphatase module tune the efficiency of select premature transcription termination events. Fujiwara R, Zhai SN, Liang D, Shah AP, Tracey M, Ma XK, Fields CJ, Mendoza-Figueroa MS, Meline MC, Tatomer DC, Yang L, Wilusz JE. Mol Cell. 2023 Nov 14:S1097-2765(23)00902-4. doi: 10.1016/j.molcel.2023.10.035. 10.1016/j.molcel.2023.10.035 PubMed 37995689