Skip to main content
Addgene

ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
(Plasmid #195047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195047 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGGA
  • Backbone size w/o insert (bp) 2137
  • Total vector size (bp) 14376
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    crtE
  • Species
    Rhodotorula toruloides
  • Insert Size (bp)
    1508
  • Promoter pADH2

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (unknown if destroyed)
  • 5′ sequencing primer atttaggtgacactatag
  • 3′ sequencing primer taatacgactcactataggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    crtI
  • Species
    Rhodotorula toruloides
  • Insert Size (bp)
    2577
  • Promoter pGPD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer atttaggtgacactatag
  • 3′ sequencing primer taatacgactcactataggg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    crtYB
  • Species
    Rhodotorula toruloides
  • Insert Size (bp)
    2258
  • Promoter pXYL

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer atttaggtgacactatag
  • 3′ sequencing primer taatacgactcactataggg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145) was a gift from Petri-Jaan Lahtvee (Addgene plasmid # 195047 ; http://n2t.net/addgene:195047 ; RRID:Addgene_195047)
  • For your References section:

    Development of a dedicated Golden Gate Assembly Platform (RtGGA) for Rhodotorula toruloides. Bonturi N, Pinheiro MJ, de Oliveira PM, Rusadze E, Eichinger T, Liudziute G, De Biaggi JS, Brauer A, Remm M, Miranda EA, Ledesma-Amaro R, Lahtvee PJ. Metab Eng Commun. 2022 May 23;15:e00200. doi: 10.1016/j.mec.2022.e00200. eCollection 2022 Dec. 10.1016/j.mec.2022.e00200 PubMed 35662893