pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
(Plasmid
#195018)
-
PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOTTC1553
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 6400
- Total vector size (bp) 7200
-
Modifications to backboneguide RNA expression cassettes were inserted into pAAV EF1a EGFP-KASH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCCGTATAGGCGGCTGCCCAA
-
Alt nameTacr1 gRNA 1 A55
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
GenBank IDNC_000072.7
- Promoter mU6
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGCACAGACTTGTGGGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP-KASH
-
SpeciesSynthetic
-
Insert Size (bp)984
- Promoter EF1a
-
Tag
/ Fusion Protein
- KASH domain of Nesprin2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTTCCGTGGTGGGCAACGTAG
-
Alt nameTacr1 gRNA 2 B108
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
GenBank IDNC_000072.7
- Promoter hU6
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAATGGACTATCATATGCTTACCGTAACTTGAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs was a gift from Christopher Richie (Addgene plasmid # 195018 ; http://n2t.net/addgene:195018 ; RRID:Addgene_195018) -
For your References section:
Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning. Belilos A, Gray C, Sanders C, Black D, Mays E, Richie CT, Sengupta A, Hake HS, Francis TC. bioRxiv [Preprint]. 2023 Oct 9:2023.02.06.527338. doi: 10.1101/2023.02.06.527338. 10.1101/2023.02.06.527338 PubMed 36798245