pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
(Plasmid #195018)

• Purpose: An adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1
• Depositing Lab: Christopher Richie
• Publication: Belilos et al bioRxiv [Preprint]. 2023 Oct 9:2023.02.06.527338. doi: 10.1101/2023.02.06.527338.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pOTTC1553
• Backbone manufacturer: NIDA GEVVC
• Backbone size w/o insert (bp): 6400
• Total vector size (bp): 7200
• Modifications to backbone: guide RNA expression cassettes were inserted into pAAV EF1a EGFP-KASH
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CCGTATAGGCGGCTGCCCAA
• Alt name: Tacr1 gRNA 1 A55
• Species: M. musculus (mouse)
• Insert Size (bp): 20
• GenBank ID: NC_000072.7
• Promoter: mU6

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTCGCACAGACTTGTGGGA

Gene/Insert 2

• Gene/Insert name: EGFP-KASH
• Species: Synthetic
• Insert Size (bp): 984
• Promoter: EF1a
• Tag / Fusion Protein:
  • KASH domain of Nesprin2 (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAAGCCTCAGACAGTGGTTC

Gene/Insert 3

• Gene/Insert name: TTCCGTGGTGGGCAACGTAG
• Alt name: Tacr1 gRNA 2 B108
• Species: M. musculus (mouse)
• Insert Size (bp): 20
• GenBank ID: NC_000072.7
• Promoter: hU6

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAATGGACTATCATATGCTTACCGTAACTTGAAAG

Resource Information

• Supplemental Documents:
  • pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry