Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
(Plasmid #195018)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195018 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOTTC1553
  • Backbone manufacturer
    NIDA GEVVC
  • Backbone size w/o insert (bp) 6400
  • Total vector size (bp) 7200
  • Modifications to backbone
    guide RNA expression cassettes were inserted into pAAV EF1a EGFP-KASH
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    CCGTATAGGCGGCTGCCCAA
  • Alt name
    Tacr1 gRNA 1 A55
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • GenBank ID
    NC_000072.7
  • Promoter mU6

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    EGFP-KASH
  • Species
    Synthetic
  • Insert Size (bp)
    984
  • Promoter EF1a
  • Tag / Fusion Protein
    • KASH domain of Nesprin2 (C terminal on insert)

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    TTCCGTGGTGGGCAACGTAG
  • Alt name
    Tacr1 gRNA 2 B108
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • GenBank ID
    NC_000072.7
  • Promoter hU6

Cloning Information for Gene/Insert 3

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs was a gift from Christopher Richie (Addgene plasmid # 195018 ; http://n2t.net/addgene:195018 ; RRID:Addgene_195018)
  • For your References section:

    Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning. Belilos A, Gray C, Sanders C, Black D, Mays E, Richie CT, Sengupta A, Hake HS, Francis TC. bioRxiv [Preprint]. 2023 Oct 9:2023.02.06.527338. doi: 10.1101/2023.02.06.527338. 10.1101/2023.02.06.527338 PubMed 36798245