Skip to main content
Addgene

(I) pXYL (J) P3 (SBE108)
(Plasmid #194991)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194991 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJET 1.2
  • Backbone size w/o insert (bp) 3004
  • Total vector size (bp) 3750
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    (I) pXYL (J)
  • Species
    Rhodotorula toruloides
  • Insert Size (bp)
    746

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCATATCCATCCGGCGTAAT
  • 3′ sequencing primer CCTGATGAGGTGGTTAGCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    (I) pXYL (J) P3 (SBE108) was a gift from Petri-Jaan Lahtvee (Addgene plasmid # 194991 ; http://n2t.net/addgene:194991 ; RRID:Addgene_194991)
  • For your References section:

    Development of a dedicated Golden Gate Assembly Platform (RtGGA) for Rhodotorula toruloides. Bonturi N, Pinheiro MJ, de Oliveira PM, Rusadze E, Eichinger T, Liudziute G, De Biaggi JS, Brauer A, Remm M, Miranda EA, Ledesma-Amaro R, Lahtvee PJ. Metab Eng Commun. 2022 May 23;15:e00200. doi: 10.1016/j.mec.2022.e00200. eCollection 2022 Dec. 10.1016/j.mec.2022.e00200 PubMed 35662893