pAS1 - pRig-3::GCaMP6f::unc-54
(Plasmid
#194970)
-
PurposeFluorescent reporter of cytosolic calcium in C.elegans.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)1351
- Promoter rig-3
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGAACTTCATTCTTCTTTTTCG
- 3′ sequencing primer TCCATGGCGGCCGGGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGCaMP6f was cloned from pJMK074 (Addgene #: 72303)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS1 - pRig-3::GCaMP6f::unc-54 was a gift from Frederic Hoerndli (Addgene plasmid # 194970 ; http://n2t.net/addgene:194970 ; RRID:Addgene_194970)