pKK1 -pFlp-18::mito4x-GCaMP6f
(Plasmid #194969)

• Purpose: Fluorescent reporter of mitochondrial matrix Ca2+.
• Depositing Lab: Frederic Hoerndli
• Publication: Subcellular imaging of neuronal calcium handling in vivo (unpublished)

Backbone

• Vector backbone: pCFJ150
• Backbone size w/o insert (bp): 12204
• Total vector size (bp): 13574
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 4 repeats of Cox8 presequence plus GCaMP6f
• Species: Synthetic
• Insert Size (bp): 1800
• Promoter: Flp-18

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTGGTGTGACTTCTTCCTTCTTCG

Resource Information

• Supplemental Documents:
  • Flp18_mitoGCaMP.gbk
• A portion of this plasmid was derived from a plasmid made by: mito4x-GCaMP6f was amplified from Addgene plasmid 127870

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Ashrafi G, de Juan-Sanz J, Farrell RJ, Ryan TA. Molecular Tuning of the Axonal Mitochondrial Ca2+ Uniporter Ensures Metabolic Flexibility of Neurotransmission. Neuron. 2020 Feb 19;105(4):678-687.e5. doi: 10.1016/j.neuron.2019.11.020. Epub 2019 Dec 17. PMID: 31862210; PMCID: PMC7035162.