pPE4max-Blasticidin
(Plasmid #194905)

• Purpose: Expressing prime editing PE4max proteins, to work in conjunction with an epegRNA encoding plasmid or Circular Vector as described in the cited article.
• Depositing Lab: George Church
• Publication: Oliynyk et al Commun Biol. 2022 Dec 21;5(1):1393. doi: 10.1038/s42003-022-04363-z.

Backbone

• Vector backbone: pCMV-PEmax-P2A-hMLH1dn
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 12117
• Total vector size (bp): 12576
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BSD
• Alt name: Blasticidin S deaminase
• Species: Synthetic
• Insert Size (bp): 396
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctgcagctggccaacctgcccgaccttta
• 3′ sequencing primer: aaggcacagtcgaggctgatcagcgggttt

Resource Information

• Supplemental Documents:
  • PE4max-Cas9-Plasmid-Addgene194905-with-Blasticidin-Resistance-Insert.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.06.28.497995v4 for bioRxiv preprint.