FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_Q418A-HA-P2A-tagBFP
(Plasmid
#194887)
-
PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-Q418A mutant and crRNA-1 and -2 targeting the human MECP2 locus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFuw
- Backbone size w/o insert (bp) 5946
- Total vector size (bp) 15631
-
Modifications to backboneFuw-TRE-HA-P2A-tagBFP
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markerstagBFP by FACS
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedLbCpf1-NLS-hCTCF_Q418A
-
SpeciesSynthetic
-
Insert Size (bp)5946
-
MutationHuman codon optimized catalytically inactive LbCpf1 (dLbCpf1) with mutation of D832A; CTCF with mutations of Q418A
- Promoter TRE
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtatgcagactttactccc
- 3′ sequencing primer taaagcagcgtatcc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-crRNA1and2
-
SpeciesSynthetic
-
Insert Size (bp)359
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggtttattacagggacag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Zeo marker is outside the LTRs and will not be packaged into virus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_Q418A-HA-P2A-tagBFP was a gift from Shawn Liu (Addgene plasmid # 194887 ; http://n2t.net/addgene:194887 ; RRID:Addgene_194887) -
For your References section:
Multiplex epigenome editing of MECP2 to rescue Rett syndrome neurons. Qian J, Guan X, Xie B, Xu C, Niu J, Tang X, Li CH, Colecraft HM, Jaenisch R, Liu XS. Sci Transl Med. 2023 Jan 18;15(679):eadd4666. doi: 10.1126/scitranslmed.add4666. Epub 2023 Jan 18. 10.1126/scitranslmed.add4666 PubMed 36652535