Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GST-RAPH1-F2
(Plasmid #194864)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194864 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-4T-1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RAPH1 1062-1250
  • Alt name
    Lamellipodin 1062-1250
  • Species
    H. sapiens (human)
  • Mutation
    amino acids 1062-1250
  • Entrez Gene
    RAPH1 (a.k.a. ALS2CR18, ALS2CR9, LPD, PREL-2, PREL2, RMO1, RalGDS/AF-6)
  • Promoter Tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This vector was synthesized from GenScript. Briefly, the gene fragment was synthesized using gene synthesis and cloned into pGEX-4T-1 using the BamHI/XhoI sites.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-RAPH1-F2 was a gift from Guillaume Jacquemet (Addgene plasmid # 194864 ; http://n2t.net/addgene:194864 ; RRID:Addgene_194864)
  • For your References section:

    Myosin-X recruits lamellipodin to filopodia tips. Popovic A, Miihkinen M, Ghimire S, Saup R, Gronloh MLB, Ball NJ, Goult BT, Ivaska J, Jacquemet G. J Cell Sci. 2023 Mar 1;136(5):jcs260574. doi: 10.1242/jcs.260574. Epub 2023 Mar 2. 10.1242/jcs.260574 PubMed 36861887