pCB20
(Plasmid
#194758)
-
PurposeALFA-tagged GluRIIA-Construct for integration at attP sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGE-attB-GMR
-
Backbone manufacturerHuang et al., 2009, PMID 19429710
- Backbone size w/o insert (bp) 6160
-
Vector typephiC31-integration vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGluRIIA
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)4294
-
Mutationnone
-
Entrez GeneGluRIIA (a.k.a. Dmel_CG6992, CG6992, D-GluRIIA, DGluR-II, DGluR-IIA, DGluR2a, DGluRIIA, DGluRIIa, DgluRII, DmelGluRIIA, Dmel\CG6992, Glu-RII, Glu-RIIA, GluR, GluR-IIA, GluR2, GluR2a, GluRII, GluRII-A, GluRIIa, GluR[[IIa]], GlurIIA, dGluRII, dGluRIIA, dglur-IIA, dglurIIA, gluIIA, gluRIIA, glurIIA, gluriia)
-
Tag
/ Fusion Protein
- ALFA-Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ggtcccgtcggcaagagaca
- 3′ sequencing primer GCGCATTTGGGTATATTGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB20 was a gift from Sven Dannhäuser (Addgene plasmid # 194758 ; http://n2t.net/addgene:194758 ; RRID:Addgene_194758) -
For your References section:
Versatile Endogenous Editing of GluRIIA in Drosophila melanogaster. Beckers CJ, Mrestani A, Komma F, Dannhauser S. Cells. 2024 Feb 10;13(4):323. doi: 10.3390/cells13040323. 10.3390/cells13040323 PubMed 38391936