Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCB19
(Plasmid #194757)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194757 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGE-attB-GMR
  • Backbone manufacturer
    Huang et al., 2009, PMID 19429710
  • Backbone size w/o insert (bp) 6160
  • Vector type
    phiC31-integration vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GluRIIA
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    4969
  • Mutation
    none
  • Entrez Gene
    GluRIIA (a.k.a. Dmel_CG6992, CG6992, D-GluRIIA, DGluR-II, DGluR-IIA, DGluR2a, DGluRIIA, DGluRIIa, DgluRII, DmelGluRIIA, Dmel\CG6992, Glu-RII, Glu-RIIA, GluR, GluR-IIA, GluR2, GluR2a, GluRII, GluRII-A, GluRIIa, GluR[[IIa]], GlurIIA, dGluRII, dGluRIIA, dglur-IIA, dglurIIA, gluIIA, gluRIIA, glurIIA, gluriia)
  • Tag / Fusion Protein
    • EGFP-Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggtcccgtcggcaagagaca
  • 3′ sequencing primer GCGCATTTGGGTATATTGAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB19 was a gift from Sven Dannhäuser (Addgene plasmid # 194757 ; http://n2t.net/addgene:194757 ; RRID:Addgene_194757)
  • For your References section:

    Versatile Endogenous Editing of GluRIIA in Drosophila melanogaster. Beckers CJ, Mrestani A, Komma F, Dannhauser S. Cells. 2024 Feb 10;13(4):323. doi: 10.3390/cells13040323. 10.3390/cells13040323 PubMed 38391936