Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

WP_010880027.1
(Plasmid #194729)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194729 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-42 b(+)
  • Backbone size w/o insert (bp) 5087
  • Total vector size (bp) 5819
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nanoparticle-proteinA and His tag
  • Species
    Synthetic
  • Insert Size (bp)
    732
  • GenBank ID
    WP_010880027.1 UniProt accession number P38507
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nde1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WP_010880027.1 was a gift from Fang Li (Addgene plasmid # 194729 ; http://n2t.net/addgene:194729 ; RRID:Addgene_194729)
  • For your References section:

    Novel virus-like nanoparticle vaccine effectively protects animal model from SARS-CoV-2 infection. Geng Q, Tai W, Baxter VK, Shi J, Wan Y, Zhang X, Montgomery SA, Taft-Benz SA, Anderson EJ, Knight AC, Dinnon KH 3rd, Leist SR, Baric RS, Shang J, Hong SW, Drelich A, Tseng CK, Jenkins M, Heise M, Du L, Li F. PLoS Pathog. 2021 Sep 7;17(9):e1009897. doi: 10.1371/journal.ppat.1009897. eCollection 2021 Sep. 10.1371/journal.ppat.1009897 PubMed 34492082