WP_010880027.1
(Plasmid
#194729)
-
PurposeLumazine synthase of the hyperthermophile Aquifex aeolicus bacterium
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-42 b(+)
- Backbone size w/o insert (bp) 5087
- Total vector size (bp) 5819
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namenanoparticle-proteinA and His tag
-
SpeciesSynthetic
-
Insert Size (bp)732
-
GenBank IDWP_010880027.1 UniProt accession number P38507
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nde1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please cite this paper: https://doi.org/10.1371/journal.ppat.1009897
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WP_010880027.1 was a gift from Fang Li (Addgene plasmid # 194729 ; http://n2t.net/addgene:194729 ; RRID:Addgene_194729) -
For your References section:
Novel virus-like nanoparticle vaccine effectively protects animal model from SARS-CoV-2 infection. Geng Q, Tai W, Baxter VK, Shi J, Wan Y, Zhang X, Montgomery SA, Taft-Benz SA, Anderson EJ, Knight AC, Dinnon KH 3rd, Leist SR, Baric RS, Shang J, Hong SW, Drelich A, Tseng CK, Jenkins M, Heise M, Du L, Li F. PLoS Pathog. 2021 Sep 7;17(9):e1009897. doi: 10.1371/journal.ppat.1009897. eCollection 2021 Sep. 10.1371/journal.ppat.1009897 PubMed 34492082