pAP28
(Plasmid
#194707)
-
PurposeLinker::3xFlag::mScarlet::HAtag::Linker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 3500
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLinker::3xFlag::mScarlet::HAtag::Linker
-
SpeciesSynthetic
-
Insert Size (bp)840
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgctgcaaggcgattaagttgg
- 3′ sequencing primer ctttatgcttccggctcgtatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP28 was a gift from Alexandre Paix (Addgene plasmid # 194707 ; http://n2t.net/addgene:194707 ; RRID:Addgene_194707) -
For your References section:
Endogenous protein tagging in medaka using a simplified CRISPR/Cas9 knock-in approach. Seleit A, Aulehla A, Paix A. Elife. 2021 Dec 6;10. pii: 75050. doi: 10.7554/eLife.75050. 10.7554/eLife.75050 PubMed 34870593