lenti GFAABC1D-dCas9-KRAB-MeCP2
(Plasmid #194701)

• Purpose: Expresses dCas9-KRAB-MeCP2 in Astrocytes
• Depositing Lab: Timothy Jarome
• Publication: Farrell et al Learn Mem. 2023 Mar 15;30(3):70-73. doi: 10.1101/lm.053716.122. Print 2023 Mar.

Backbone

• Vector backbone: lenti SYN-dCas9-KRAB-MeCP2
• Backbone manufacturer: Jeremy Day Addgene plasmid #155365
• Backbone size w/o insert (bp): 13000
• Total vector size (bp): 13691
• Modifications to backbone: Removed hSYN promoter
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GFAABC1D promoter
• Species: H. sapiens (human)
• Insert Size (bp): 692
• Mutation: None
• Promoter: GFAABC1D
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: gcgccaattctgcagacaaa (5` --> 3`)
• 3′ sequencing primer: tacttcttgtcggctgctgg (5` --> 3`)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pTYF-1xGfaABC1D-tTA was a gift from Sergey Kasparov (Addgene plasmid # 19977 ; http://n2t.net/addgene:19977 ; RRID:Addgene_19977)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry