Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lenti GFAABC1D-dCas9-KRAB-MeCP2
(Plasmid #194701)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194701 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lenti SYN-dCas9-KRAB-MeCP2
  • Backbone manufacturer
    Jeremy Day Addgene plasmid #155365
  • Backbone size w/o insert (bp) 13000
  • Total vector size (bp) 13691
  • Modifications to backbone
    Removed hSYN promoter
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFAABC1D promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    692
  • Mutation
    None
  • Promoter GFAABC1D
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer gcgccaattctgcagacaaa (5` --> 3`)
  • 3′ sequencing primer tacttcttgtcggctgctgg (5` --> 3`)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pTYF-1xGfaABC1D-tTA was a gift from Sergey Kasparov (Addgene plasmid # 19977 ; http://n2t.net/addgene:19977 ; RRID:Addgene_19977)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti GFAABC1D-dCas9-KRAB-MeCP2 was a gift from Timothy Jarome (Addgene plasmid # 194701 ; http://n2t.net/addgene:194701 ; RRID:Addgene_194701)
  • For your References section:

    Neuronal and astrocytic protein degradation are critical for fear memory formation. Farrell K, McFadden T, Jarome TJ. Learn Mem. 2023 Mar 15;30(3):70-73. doi: 10.1101/lm.053716.122. Print 2023 Mar. 10.1101/lm.053716.122 PubMed 36921984