pABE8e-NG-403Q-Nterm-AAV
(Plasmid #194651)

• Purpose: N-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in mice
• Depositing Lab: David Liu
• Publication: Reichart et al Nat Med. 2023 Feb;29(2):412-421. doi: 10.1038/s41591-022-02190-7. Epub 2023 Feb 16.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: modified pX601
• Backbone size w/o insert (bp): 4735
• Total vector size (bp): 7348
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ABE8e-NG N-term
• Alt name: ABE8e-SpCas9-NG
• Alt name: ABE8e
• Species: Synthetic
• Insert Size (bp): 2739
• Promoter: TNNT2
• Tags / Fusion Proteins:
  • BPNLS (N terminal on insert)
  • BPNLS (C terminal on insert)
  • NpuN spilt intein (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAGGCTAGCCTCGAGAATTCAC
• 3′ sequencing primer: GGCACAGTCGCACCACGGAATTGTCAGTGCC

Resource Information

• Supplemental Documents:
  • pABE8e-NG-403Q-Nterm-AAV.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry