Skip to main content
Addgene

pABE8e-NG-403Q-Nterm-AAV
(Plasmid #194651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194651 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    modified pX601
  • Backbone size w/o insert (bp) 4735
  • Total vector size (bp) 7348
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ABE8e-NG N-term
  • Alt name
    ABE8e-SpCas9-NG
  • Alt name
    ABE8e
  • Species
    Synthetic
  • Insert Size (bp)
    2739
  • Promoter TNNT2
  • Tags / Fusion Proteins
    • BPNLS (N terminal on insert)
    • BPNLS (C terminal on insert)
    • NpuN spilt intein (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGCTAGCCTCGAGAATTCAC
  • 3′ sequencing primer GGCACAGTCGCACCACGGAATTGTCAGTGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pABE8e-NG-403Q-Nterm-AAV was a gift from David Liu (Addgene plasmid # 194651 ; http://n2t.net/addgene:194651 ; RRID:Addgene_194651)
  • For your References section:

    Efficient in vivo genome editing prevents hypertrophic cardiomyopathy in mice. Reichart D, Newby GA, Wakimoto H, Lun M, Gorham JM, Curran JJ, Raguram A, DeLaughter DM, Conner DA, Marsiglia JDC, Kohli S, Chmatal L, Page DC, Zabaleta N, Vandenberghe L, Liu DR, Seidman JG, Seidman C. Nat Med. 2023 Feb;29(2):412-421. doi: 10.1038/s41591-022-02190-7. Epub 2023 Feb 16. 10.1038/s41591-022-02190-7 PubMed 36797483