Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMET7-GAG-eDHFR
(Plasmid #194635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMET7
  • Backbone size w/o insert (bp) 2956
  • Total vector size (bp) 6278
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p55 GAG
  • Alt name
    gag
  • Species
    HIV1
  • Insert Size (bp)
    1500
  • Promoter SRalpha
  • Tag / Fusion Protein
    • ecDHFR (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site none (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATCAAAGAACTGCTCCTC
  • 3′ sequencing primer GTAACCATTATAAGCTGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMET7-GAG-eDHFR was a gift from Sven Eyckerman (Addgene plasmid # 194635 ; http://n2t.net/addgene:194635 ; RRID:Addgene_194635)
  • For your References section:

    Trapping mammalian protein complexes in viral particles. Eyckerman S, Titeca K, Van Quickelberghe E, Cloots E, Verhee A, Samyn N, De Ceuninck L, Timmerman E, De Sutter D, Lievens S, Van Calenbergh S, Gevaert K, Tavernier J. Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416. 10.1038/ncomms11416 PubMed 27122307