pMET7-GAG-GW
(Plasmid #194634)

• Purpose: Gateway destination vector for mammalian expression of Virotrap bait constructs
• Depositing Lab: Sven Eyckerman
• Publication: Eyckerman et al Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416.

Backbone

• Vector backbone: pMET7
• Backbone size w/o insert (bp): 2956
• Total vector size (bp): 6278
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: p55 GAG
• Alt name: gag
• Species: HIV1
• Insert Size (bp): 1500
• Promoter: SRalpha
• Tag / Fusion Protein:
  • PQS1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: none (unknown if destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATCAAAGAACTGCTCCTC
• 3′ sequencing primer: GTAACCATTATAAGCTGCAA

Resource Information

• Supplemental Documents:
  • pMET7-GAG-SP1-GW.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry