PB-CRX-T2A-NeuroD1
(Plasmid
#194607)
-
PurposePiggybac Tet-ON plasmid for inducing hiPSCs into photoreceptor-like cells via CRX and NeuroD1 expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-TA-ERN (Addgene #80474 )
- Backbone size w/o insert (bp) 9614
- Total vector size (bp) 11636
-
Vector typeMammalian Expression ; piggyBac transposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRX-T2A-NeuroD1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2022
-
GenBank IDNM_000554(CRX) NM_002500.5 (NeuroD1)
- Promoter tetO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tccatagaagacaccgggac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-CRX-T2A-NeuroD1 was a gift from Haruhisa Inoue (Addgene plasmid # 194607 ; http://n2t.net/addgene:194607 ; RRID:Addgene_194607) -
For your References section:
One-step induction of photoreceptor-like cells from human iPSCs by delivering transcription factors. Otsuka Y, Imamura K, Oishi A, Kondo T, Suga M, Yada Y, Shibukawa R, Okanishi Y, Sagara Y, Tsukita K, Tsujikawa A, Inoue H. iScience. 2022 Mar 8;25(4):103987. doi: 10.1016/j.isci.2022.103987. eCollection 2022 Apr 15. 10.1016/j.isci.2022.103987 PubMed 35330684