pHAGE-EFS-foldon-GFP- PCP
(Plasmid
#194503)
-
PurposeExpression foldon-GFP-PCP protein for imaging of nonrepetitive DNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 5882
- Total vector size (bp) 7453
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefoldon-GFP-PCP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1305
- Promoter EF-1α core promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taaggtgaacgcgtgcaggctggcgccaccatgggctacatccccgaggcccccagggac
- 3′ sequencing primer ctcgaggctcccatcgatgccagagcggccgccagaacttccggatccacctccactagt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EFS-foldon-GFP- PCP was a gift from Chunqing Song (Addgene plasmid # 194503 ; http://n2t.net/addgene:194503 ; RRID:Addgene_194503) -
For your References section:
CRISPR FISHer enables high-sensitivity imaging of nonrepetitive DNA in living cells through phase separation-mediated signal amplification. Lyu XY, Deng Y, Huang XY, Li ZZ, Fang GQ, Yang D, Wang FL, Kang W, Shen EZ, Song CQ. Cell Res. 2022 Nov;32(11):969-981. doi: 10.1038/s41422-022-00712-z. Epub 2022 Sep 14. 10.1038/s41422-022-00712-z PubMed 36104507