Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRN3P-NLS-EGFP-deadBtgh-3NLS
(Plasmid #194470)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRN3P-H3.3-K9R-Gfp
  • Backbone size w/o insert (bp) 3159
  • Total vector size (bp) 4335
  • Vector type
    for In Vitro Transcription from T3 promoter after linearization

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Plasmid copy number is intermediate.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BtGH84
  • Species
    B. thetaiotaomicron VPI-5482
  • Mutation
    Aspartic Acid 242 (in Dennis et al.) changed to Alanine
  • Tags / Fusion Proteins
    • mGFP5 (N terminal on insert)
    • SV40 Nuclear Localization Signals (C terminal on insert)
    • SV40 Nuclear Localization Signal (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer actttcacttatggtgttcaatgc
  • 3′ sequencing primer gacgccaccactgattacatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Paper describing the insert and the D242A mutation: Dennis, R. J. et al. Structure and mechanism of a bacterial β-glucosaminidase having O-GlcNAcase activity. Nat. Struct. Mol. Biol. 13, 365–371 (2006).
Paper of lab donating backbone, also using pRN3P backbone: Eid, A., Rodriguez-Terrones, D., Burton, A. & Torres-Padilla, M. E. SUV4-20 activity in the preimplantation mouse embryo controls timely replication. Genes Dev. 30, 2513–2526 (2016).
Paper using plasmid from which Btgh insert was amplified: Boulard, M., Edwards, J. R. & Bestor, T. H. Protein O-GlcNAcylation Silences Methylated Promoters.
Please visit https://www.biorxiv.org/content/10.1101/2024.01.22.576677v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRN3P-NLS-EGFP-deadBtgh-3NLS was a gift from Mathieu Boulard (Addgene plasmid # 194470 ; http://n2t.net/addgene:194470 ; RRID:Addgene_194470)
  • For your References section:

    Perturbing Nuclear Glycosylation in the Mouse Preimplantation Embryo Slows Down Embryonic Growth. Formichetti S, Chitnavis U, Sadowska A, Liu N, Boskovic A, Boulard M. Dev Cell 10 Jan 2024 10.2139/ssrn.4687768