pRN3P-NLS-EGFP-Btgh-3NLS
(Plasmid #194469)

• Purpose: Encodes for bacterial O-GlcNAcase BtGH84 fused to enhanced GFP and NLSs for effective nuclear localization, in backbone for T3 In Vitro Transcription.
• Depositing Lab: Mathieu Boulard
• Publication: Formichetti et al Dev Cell 10 Jan 2024

Backbone

• Vector backbone: pRN3P-H3.3-K9R-Gfp
• Backbone size w/o insert (bp): 3159
• Total vector size (bp): 4335
• Vector type: Bacterial Expression ; for In Vitro Transcription from T3 promoter after linearization

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Copy number of plasmid is intermediate.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BtGH84
• Species: B. thetaiotaomicron VPI-5482
• Insert Size (bp): 2148
• Tags / Fusion Proteins:
  • mGFP5 (N terminal on insert)
  • SV40 Nuclear Localization Signals (C terminal on insert)
  • SV40 Nuclear Localization Signal (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: actttcacttatggtgttcaatgc
• 3′ sequencing primer: gacgccaccactgattacatgc

Resource Information

• Supplemental Documents:
  • pRN3P-NLS-EGFP-Btgh-3NLS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Paper describing the insert: Dennis, R. J. et al. Structure and mechanism of a bacterial β-glucosaminidase having O-GlcNAcase activity. Nat. Struct. Mol. Biol. 13, 365–371 (2006).
Paper of lab donating backbone, also using pRN3P backbone: Eid, A., Rodriguez-Terrones, D., Burton, A. & Torres-Padilla, M. E. SUV4-20 activity in the preimplantation mouse embryo controls timely replication. Genes Dev. 30, 2513–2526 (2016).
Paper using plasmid from which Btgh insert was amplified: Boulard, M., Edwards, J. R. & Bestor, T. H. Protein O-GlcNAcylation Silences Methylated Promoters.
Please visit https://www.biorxiv.org/content/10.1101/2024.01.22.576677v1 for bioRxiv preprint.